AM1241 | Stat signal

Abstract
Activation of cannabinoid receptor type II (CB2R) by AM1241 has been demonstrated to protect dopaminergic neurons in Parkinson’s disease (PD) animals. However, the specific mechanisms of the action of the CB2R agonist AM1241 for PD
treatment have not been characterized. Wild‐type (WT), CB1R knockout (CB1‐KO),
and CB2R knockout (CB2‐KO) mice were exposed to 1‐methyl‐4‐phenyl‐1,2,3, 6‐tetrahydropyridine (MPTP) for 1 week to obtain a PD mouse model. The therapeutic effects of AM1241 were evaluated in each group. Behavioral tests,
analysis of neurotransmitters, and immunofluorescence results demonstrated that
AM1241 ameliorated PD in WT animals and CB1‐KO animals. However, AM1241 did not ameliorate PD symptoms in CB2‐KO mice. RNA‐seq analysis identified the lncRNA Xist as an important regulator of the protective actions of AM1241.
Specifically, AM1241 allowed WT and CB1‐KO animals treated with MPTP to maintain normal expression of Xist, which affected the expression of miR‐133b‐3p
and Pitx3. In vitro, overexpression of Xist or AM1241 protected neuronal cells from death induced by 6‐hydroxydopamine and increased Pitx3 expression. The CB2
receptor agonist AM1241 alleviated PD via regulation of the Xist/miR‐133b‐3p/Pitx3
axis, and revealed a new approach for PD treatment.

KEYW ORD S
AM1241, CB2R, miR‐133b‐3p, Parkinson’s disease, Xist
1Division of Spine, Department of Orthopedics, School of Life Science and Technology, Tongji Hospital affiliated to Tongji University, Tongji University, Shanghai, China
2Key Laboratory of Spine and Spinal Cord Injury Repair and Regeneration, Tongji University, Ministry of Education, Shanghai, China
3Department of Neurology, Tongji Hospital, Tongji University School of Medicine, Tongji University, Shanghai, China
4Research Center for Translational Medicine at East Hospital, Tongji University,
Shanghai, China

Correspondence
Lingjing Jin, Shilong Wang and Rongrong Zhu, Division of Spine, Department of Orthopedics, Tongji Hospital affiliated to Tongji University, School of Life Science and Technology,
Tongji University, Shanghai, China. Email: [email protected] (L. J.); [email protected] (S. W.) and [email protected] (R. Z.)

Funding information
National Key Research and Development Program, Grant/Award Number: 2016YFA0100800; National Natural Science Foundation of China, Grant/Award Numbers: 31727801, 31770923, 81671105, 81873994;
Funds for International Cooperation and Exchange of the National Natural Science Foundation of China, Grant/Award Number: 8182010801

1 | INTRODUCTION

Parkinson’s disease (PD), affects over 1% of individuals over
60 years of age worldwide (Soukup, Vanhauwaert, & Verstreken, 2018). Although many drug therapies are available for the treatment of PD, these drugs do not significantly affect disease progression (Connolly & Lang, 2014; Malek & Grosset, 2015). Many approved drugs such as levodopa augment dopaminergic transmission. How- ever, the use of these drugs is limited by significant side effects and complications (Djamshidian & Poewe, 2016; Whitfield, Moore, &
Daniels, 2014). As such, there is a great need to develop novel treatments for PD that act through different mechanisms than the treatments currently commercially available.
The cannabinoid signaling system is very important in PD (Coccurello & Bisogno, 2016; More & Choi, 2015). Endocannabinoids increase and cannabinoid receptors are activated in PD patients (Jiang, Pu, Han, Hu, & He, 2009; Walsh et al., 2010). The cannabinoids are supposed to exert their protective effects with the help of the
G‐protein‐coupled type 1 cannabinoid receptor (CB1R) and type 2
cannabinoid receptor (CB2R). Changes in CB1R gene expression

2 |

were observed in animal models of PD and in human postmortem brain tissue (Hurley, Mash, & Jenner, 2003). Furthermore, regional alterations in CB1R expression have been shown in patients with PD (Van Laere et al., 2012). CB2R gene expression was decreased
in individuals with PD (Garcia, Cinquina, Palomo‐Garo, Rabano, &
Fernandez‐Ruiz, 2015; Grunblatt et al., 2007). In addition, over- expression of CB2R in mice markedly reduced dopaminergic lesions induced by 6‐hydroxydopamine (6‐OHDA), resulting in decreased motor impairment and reduced loss of dopaminergic neurons
(Ternianov et al., 2012). An updated study suggested that CB2R controls the behavior of animal and dopamine‐dependent neuronal activity (Zhang et al., 2014).
AM1241 is a specific CB2R agonist and has been reported as an effective treatment for migraines, stroke, and neuropathic pain (Greco, Mangione, Sandrini, Nappi, & Tassorelli, 2014; Niu et al., 2017; Yu et al., 2015). An important advantage of AM1241 is that it does not induce any psychotropic effects associated with activation of CB1R, suggesting AM1241 is safe (Atwood & Mackie, 2010;
Garcia‐Gutierrez, Garcia‐Bueno, Zoppi, Leza, & Manzanares, 2012).
Our previous study showed that AM1241 exerted promising
therapeutic effects on PD animals and may protect dopaminergic neurons (DA) after 1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine (MPTP) treatment (Shi et al., 2017). However, the underlying
mechanisms have yet to be characterized.
Long noncoding RNAs (lncRNAs) with limiting protein‐coding
potential are becoming vital for the PD process. Recently, various pieces of evidences have implicated that lncRNAs are involved in PD (Feng, Jankovic, & Wu, 2015; Majidinia et al., 2016; Wu et al., 2013). lncRNA Xist is regarded as a high confidence distinct gene biomarker of PD (Sun et al., 2014), and reactivation of Xist has been of considerable interest for treatment of severe neurodevelopmental disorder and Rett syndrome (RTT; Carrette, Blum, Ma, Kelleher, & Lee, 2018). All these studies motivated us that Xist plays a significantly vital role in PD. However, the specific role and associated molecular mechanisms that govern the involvement of Xist in PD have not been characterized.
We performed behavioral testing, analyzed neurotransmitters,
evaluated neural marker expression, and performed transcriptome sequencing analysis to study the function of AM1241 in WT, CB1R‐
KO (abbreviated as CB1‐KO), and CB2R‐KO (abbreviated as CB2‐
KO) PD mice. According to our results, AM1241 exerted neuropro- tective effects in WT animal and CB1‐KO animals, but not CB2‐KO animals. Furthermore, we demonstrate that AM1241 could promote
induction of CB2R and regulate the Xist/miR‐133b‐3p/Pitx3 axis in WT animals and CB1‐KO animals. Our findings may represent a viable therapeutic strategy for treatment of PD.

⦁ | MATERIALS AND METHODS

⦁ | Materials

MPTP and levodopa (L‐DOPA) were obtained from Sigma. AM1241 was bought from APExBIO Technology (Houston).
Penicillin G, streptomycin, and trypsinase were purchased from KeyGen (Nanjing).

⦁ | Cell culture

PC12 provided by the Stem Cell Bank of the Chinese Academy of Sciences, was maintained in Dulbecco’s modified Eagle’s medium, 5% fetal bovine serum and 10% horse serum in a 5% CO2 incubator maintained at 37°C.

⦁ | Induction of PD in CB1 and CB2 knockout mice and drug provided

CB1R gene and CB2R gene knockout animal were purchased from Bioray Laboratories. Female C57BL/6N mice were used as controls, and all animals were 9–12 weeks of age. All experiments were authorized by the Institutional Research Ethics Committee of Tongji University.

⦁ | PD animal model

Animals were treated with MPTP (30 mg/kg, i.p.) on five consecutive days according to a previous study (Blandini & Armentero, 2012). Tweleve groups were set up in our research: (1) WT animals given saline; (2) WT animals injected with MPTP for the first 5 days only; (3) WT mice injected with MPTP for the first 5 days only followed by AM1241 (6 mg/kg) for 2 weeks;
(4) WT mice treated with MPTP for the first 5 days only followed
by L‐DOPA (10 mg/kg) for 2 weeks; (5) CB1 knockout mice (CB1‐KO) treated with saline; (6) CB1 knockout mice (CB1‐KO) treated with MPTP for the first 5 days only; (7) CB1 knockout
mice (CB1‐KO) treated with MPTP for the first 5 days only followed by AM1241; (8) CB1 knockout mice treated with MPTP for the first 5 days only followed by L‐DOPA; (9)CB2 knockout
mice (CB2‐KO) treated with saline; (10) CB2 knockout mice
(CB2‐KO) treated with MPTP only; (11) CB2 knockout mice (CB2‐KO) treated with MPTP for the first 5 days only followed by AM1241; (12) CB2 knockout mice treated with MPTP for the
first 5 days only followed by L‐DOPA.
The behavioral changes in MPTP administered mice were detected after the day of MPTP treatment and verified again before the drug was given again to make sure the mice used for the following experiment were all PD mice. We also noticed that there was a very small number of mice (about 5%) exhibiting a spontaneous reversal of behavioral parameters at the time before AM1241 treatment, and we discarded these mice for further study. And the
most important of all, 2 weeks after AM1241 treatment, in only the MPTP‐treated group, the mice showed no significant change with themselves 2 weeks ago, which denotes the stability of the PD model
during drug treatment.

⦁ | Behavioral tests

Behavioral tests and the measurement of neurotransmitters were performed after the whole process of drug provided.
To determine the behavioral effects of the administered drugs, the mice were subjected to the Pole Test (He et al., 2017) and forced swim test (FST). In short, animals climbed down from the top of the pole and the times were recorded when the animal reaching the bottom of the pole. The FST and pole test were repeated three times
and a blinded experimental design was used. Mice were pre‐trained
before being subjected to the tests and were allowed to rest for 1 day before repeating a test.

⦁ | DA and NE detection

Mouse striata and substantia nigras were collected, suspended in 400 μl of phosphate buffered saline (PBS), homogenized, mixed with 800 μl of acetonitrile, then centrifuged (He et al., 2016). The supernatants were
kept and injected onto an high‐performance liquid chromatography
(HPLC). Protein concentrations for each brain region were quantified and the results are presented as the concentrations of DA/norepinephrine (NE) per mg protein.

⦁ | Immunofluorescence

Mouse brains were fixed in 4% ice‐cold paraformaldehyde for 3 hr and immersed in 20% sucrose for 48 hr. The brains were sliced into 15‐μm sections. Immunocytochemistry analysis was performed using standard protocols. Slides were then incubated with primary
antibodies (4°C, overnight). Antibodies specific to tyrosine hydro- xylase (TH; (Alexa Fluor® 488; 1:500, ab192463; Abcam) were used to identify dopaminergic neurons. After washing three times with PBS, RedDot1 (Biotium) was used to stain the nuclei.

⦁ | RNA‐seq

RNA was obtained from the mouse substantia nigras using TRIZol reagent (Takara) and was subjected to RNA sequencing. RNA sequencing was performed by BGI (Shenzhen, China).

⦁ | Quantitative reverse transcription polymerase chain reaction (qRT‐PCR)

qRT‐PCR was carried using a mature protocol. The primers (Table 1) were obtained from Shanghai Generay Biotech Co., Ltd. All mRNA levels were normalized to glyceraldehyde 3‐phosphate dehydrogenase
(GAPDH). For miR‐133‐3p, a miRcute Plus miRNA First‐Strand cDNA
Synthesis Kit and miRcute Plus miRNA qPCR Detection Kit supplied by TransGen Biotech were used, U6 was regarded as the control.
TABLE 1 Primer sequences for qPCR of target genes
Primer name Primer sequence
GAPDH Forward primer: 5′‐AGGTCGGTGTGAACGGATTTG‐3′ Reverse primer: 5′‐TGTAGACCATGTAGTTGAGGTCA‐3′

Nr4a2 Forward primer: 5′‐GTGTTCAGGCGCAGTATGG‐3′ Reverse primer: 5′‐TGGCAGTAATTTCAGTGTTGGT‐3′
miR‐133b‐3p Forward primer: 5′‐ACGATTTGGTCCCCTTCAAC‐3′ U6 Forward primer: 5′‐CTCGCTTCGGCAGCACA‐3′
Reverse primer: 5′‐AACGCTTCACGAATTTGCGT‐3′

Abbreviations: CB2R, cannabinoid receptor type II; GAPDH, glyceralde- hyde 3‐phosphate dehydrogenase; miR, microRNA; qPCR, quantitative polymerase chain reaction.

⦁ | Western blot analysis

Protein was extracted and a BCA protein assay kit was applied to quantify protein. Antibodies specific to Pitx3 (1:500; Bioss;
bs‐2364R) and GAPDH (1:1,000; CST; 97166) were used. Anti‐
mouse and anti‐rabbit secondary antibodies were used.

⦁ | Luciferase assays

The wild type or mutant miR‐133b‐3p (RiboBio) binding site of XIST was designed and subcloned into pMirTarget (Origene). The wild‐type (WT) or mutant (MUT) miR‐133b‐3p binding site in the
3′‐untranslated region (3′‐UTR) of Pitx3 was also constructed and
subcloned into pMirTarget. pCMV‐Xist‐PA (pcDNA/XIST) was a gift
from Rudolf Jaenisch (Addgene plasmid #26760) used for over- expression of XIST (Wutz & Jaenisch, 2000).
To investigate the binding between XIST and miR‐133b‐3p, PC12
cells were seeded onto 96 well plates and transfected with 50 ng
of XIST WT or XIST MUT and 200 ng of miR‐133b‐3p or miR‐NC and 2 ng pRL‐TK using Lipofectamine 3000. To understand the effect of overexpression of XIST on Pitx3 expression, the cells were
transfected with 200 ng miR‐133b‐3p or miR‐NC, 50 ng Pitx3 WT 3′‐UTR or Pitx3 MUT 3′‐UTR containing the firefly luciferase reporter, pcDNA‐NC or pcDNA/XIST, and 2 ng pRL‐TK. After
48 hr, the cells were harvested and analyzed using a luciferase assay kit (Beyotime).

⦁ | 3‐(4,5‐dimethylthiazol‐2‐yl)‐2, 5‐diphenyltetrazolium bromide (MTT) assay

6‐OHDA was used to induce a cellular model of PD with PC12 cells (Dong et al., 2015; Shah et al., 2014). The cells were administered

FIG U RE 1 AM1241 improved PD animal behavioral recovery and neurotransmitter release. (a) Scheme showing the mouse model of PD and drug administration. (b) AM1241 improves behavioral recovery from PD in WT and CB1‐KO mice, float time in FST and time to climb the pole in the pole test. (c) Concentration of DA in the striatum. (d) Concentration of DA in the substantia nigra. (e) NE concentration in the striatum.
(f) NE concentration in the substantia nigra. CB1‐KO, CB1R knockout; FST, forced swim test; PD, Parkinson’s disease; WT, wild type

different concentrations of 6‐OHDA (50, 100, 200, 300, 400, and 500 μM) for 24 hr, and MTT assay (Sangon) was used to detect cell viability. Based on the cell viability results, 200 μM 6‐OHDA was applied in other experiments.
To study the protective effects of AM1241 or XIST over- expression, the cells were plated and the following eight groups
were set up: Control, 6‐OHDA, 6‐OHDA plus AM1241 (4, 20, and
100 μM), 6‐OHDA plus pcDNA/XIST (100, 200, and 300 ng). The cells
were treated 24 hr later. The Vehicle, AM1241, or pcDNA/XIST groups were administered 24 hr before 6‐OHDA treatment.

⦁ | Statistical analysis

All results are shown as means ± standard deviations (SD). Statistical significance was analyzed using a one‐way or two‐way analysis

of variance, *p < .05, **p < .01 and ***p < .001 were regarded as statistically significant.

⦁ | RESULTS

⦁ | AM1241 promoted motor function recovery and increases DA and NE level in WT/CB1‐KO PD mice

WT, CB1‐KO, and CB2‐KO animals were injected with MPTP followed by AM1241 or L‐DOPA, as shown in Figure 1a. In this
study, FST and Pole Test were used to evaluate motor function. The results (Figure 1b) showed that for FST, WT mice injected with AM1241 spent more time to float compared to WT animal injected with only MPTP (57 s vs 86 s), and this increased float times from
50 s to 77 s in CB1‐KO animal. For CB2‐KO mice, no significant
differences occurred between the MPTP and the AM1241 groups.
For the pole test, the mice treated with MPTP took more time to climb down the pole than the control. WT mice injected with AM1241 reduced climbing times from 11.0 to 8.7 s compared to WT animals injected with only MPTP, and this reduced climbing times
from 14.6 to 9.2 s in CB1‐KO animals, demonstrating that mice given
AM1241 were much faster. However, in CB2‐KO mice there were no big differences between the MPTP and the AM1241 groups. Results
of the Pole Test demonstrated that AM1241 effectively reversed MPTP‐induced motor deficits in WT and CB1‐KO mice, but not in
CB2‐KO mice. The lack of these effects in CB2‐KO animals was due
to loss of CB2R, which eliminated the receptor for AM1241, thus preventing signaling.
Mouse striata and substantia nigras were harvested for quantita-
tion of DA and NE by HPLC. As shown in Figure 1c,d, there was a remarkable decrease of DA after MPTP treatment. The CB2‐KO animals administered AM1241 did not exhibit greater DA levels compared to the MPTP group. For the WT and CB1‐KO group, AM1241 markedly enhanced DA release in the striata and substantia nigras of MPTP‐treated mice. NE levels were also measured, and the results are summarized in Figure 1e,f. MPTP significantly decreased
NE, and the decrease was reversed by injecting AM1241 in WT and CB1‐KO groups. In contrast, CB2‐KO PD mice did not exhibit greater
NE release in response to treatment with AM1241. Recovery of DA and NE levels in WT and CB1‐KO PD mice in response to AM1241 treatment implied that AM1241 effectively increased the levels of
neurotransmitters in PD mice. The lack of recovery of DA and NE levels in CB2‐KO animals shows that the CB2 receptor is necessary for AM1241 activity.

⦁ | AM1241 protected dopaminergic neurons from MPTP‐induced cell death in WT and CB1‐KO PD mice

To examine the effects of AM1241 on dopaminergic neuron survival, we used TH as a dopaminergic neuron biomarker, as shown in Figure 2. MPTP induced significantly more dopaminergic cell death in the substantia nigra compared to control. However, the number
of neurons was increased in the WT and CB1‐KO PD group after
AM1241 injection. However, no increase in TH‐positive cells was detected in CB2‐KO PD mice after treatment with AM1241.

⦁ | RNA‐seq analysis of neuroprotective effects induced by AM1241

We carried out RNA‐seq analysis to investigate gene expression. We
listed the 19 most relevant genes (Figure 3a), which were mostly involved in neurodevelopment, of which Xist was the most obvious, also, it is very important in PD. 2D principal component analysis
clearly identified the WT PD group, the CB1‐KO PD group, the CB2‐
KO PD group, and the AM1241‐treated CB2‐KO PD group as the most different from the control group (Figure 3b). We identified eight associated KEGG pathways from the AM1241‐treated PD mouse groups versus the PD mouse groups (Figure 3c), of which endocrine resistance and ECM‐receptor interaction changed most significantly. To explore the effects of AM1241 in more detail, we analyzed the expression of multiple PD‐related markers (Park2, Nr4a2 and Pitx3). In the substantia nigra compacta, Pitx3 is involved in the specification
and terminal differentiation of mesencephalic dopaminergic neurons that are lost in PD (Suarez, Alberquilla, Garcia‐Montes, & Moratalla, 2018). Compared to the control group, the mRNA levels of Park2,

FIG U RE 2 AM1241 promoted TH‐positive cell survival after MPTP treatment in WT and CB1‐KO PD mice
substantia nigras. Representative immunofluorescence images of TH expression in the substantia nigra.
CB1‐KO, CB1R knockout; MPTP, 1‐methyl‐4‐phenyl‐1,2,3,6‐
tetrahydropyridine; PD, Parkinson's disease; TH, tyrosine hydroxylase; WT, wild type

FIG U RE 3 RNA‐seq analysis of neuroprotective effects induced by AM1241. (a) Heat map that represents the gene‐expression pattern of transcription factors in the substantia nigra. (b) 2D principal component analysis using genome‐wide expression data. (c) KEGG pathway analysis of AM1241 vs MPTP‐treated WT mice. The sequence of a1‐c4 is in accordance with other figures, and refers to Control, MPTP + WT, MPTP + AM1241 +WT, MPTP + L‐DOPA + WT, MPTP + CB1‐KO, MPTP + AM1241 + CB1‐KO, MPTP + L‐DOPA + CB1‐KO, MPTP + CB2‐KO,
MPTP + AM1241 + CB2‐KO, MPTP + L‐DOPA+ CB2‐KO, respectively. (d–h) qRT‐PCR analysis of Park2, Nr4a2, Xist, miR‐133b‐3p, and Pitx3 mRNA expression, expression levels were normalized to GAPDH. CB1‐KO, CB1R knockout; KEGG, Kyoto Encyclopedia of Genes and Genomes; L‐DOPA, levodopa; MPTP, 1‐methyl‐4‐phenyl‐1,2,3,6‐tetrahydropyridine; qRT‐PCR, quantitative reverse transcription polymerase chain
reaction; WT, wild type

Nr4a2, and Pitx3 in the substantia nigra (Figure 3d,e,h) were significantly reduced following MPTP treatment. Treatment with AM1241 resulted in an obvious increase in the mRNA levels of Park2,
Nr4a2, and Pitx3 when compared with the WT and CB1‐KO PD group.
However, AM1241 did not increase the mRNA levels of Park2, Nr4a2, and Pitx3 compared to CB2‐KO PD. These results were consistent
with the RNA‐seq results. Based on the RNA‐seq results, we evaluated
Xist, which showed the greatest change in the RNA‐seq analysis. The
results (Figure 3f) showed Xist mRNA expression was much lower in the WT PD group, the CB1‐KO PD group, the CB2‐KO PD group, and
the AM1241‐treated CB2‐KO PD group than in the control group.
miR‐133b‐3p was predicted to be a direct microRNA target regulated
by XIST as determined by bioinformatics analysis. We examined the mRNA expression of miR‐133b‐3p in the different groups and
observed that miR‐133b‐3p was significantly upregulated in WT PD
mice, CB1‐KO PD mice, CB2‐KO PD mice, and AM1241‐treated

CB2‐KO PD mice (Figure 3g), which represented an opposite trend to that observed with Xist and Pitx3.
The qRT‐PCR results demonstrated that AM1241 could benefit WT and CB1‐KO PD mice by increasing Park2, Nr4a2, and Pitx3 levels in the substantia nigra, but could not benefit CB2‐KO PD mice.
According to these, we proposed that AM1241, a CB2R agonist, may exert its neuroprotective effects through the Xist/miR‐133b‐3p/ Pitx3 axis.

⦁ | AM1241 displays neuroprotective action via the Xist/miR‐133b‐3p/Pitx3 axis

Bioinformatics analyses were carried to predict the binding regions
between miR‐133b‐3p and XIST, and miR‐133b‐3p and Pitx3 (Figure 4a). To study the relationship between miR‐133b‐3p and

XIST, a luciferase reporter assay was performed, which verified that upregulation of miR‐133b‐3p could inhibit fluorescence intensity in PC12 cells transfected with the vector XIST WT, but not the XIST Mut vector (Figure 4b). These results suggested that miR‐133b‐3p was a possible target of XIST.
To understand the function of miR‐133b‐3p in PD, we used bioinformatics analysis to find targets of miR‐133b‐3p. The results showed that Pitx3 was a possible target of miR‐133b‐3p (Figure 4a).
Luciferase reporter experiments were used to study whether
miR‐133b‐3p could change the expression levels of Pitx3. After PC12 cells were transfected with miR‐133b‐3p, the relative luciferase activity of the Pitx3 WT was weakened, further suggesting
that Pitx3 is a target of miR‐133b‐3p. We also investigated whether overexpression of XIST could restore Pitx3 expression, the results showed that when Pitx3 WT was transfected with miR‐133b‐3p and pcDNA/XIST into PC12 cells, Pitx3 WT luciferase activity was restored. Luciferase activity was not restored in miR‐133b‐3p and
miR‐133b‐3p + pcDNA‐NC‐treated cells. The luciferase activity of
Pitx3 Mut remained unchanged in PC12 cells after transfection (Figure 4c). These data verified that XIST diminished miRNA‐induced
repression of the Pitx3 3′‐UTR by targeting miR‐133b‐3p.
Western blot and qRT‐PCR experiments showed that over- expression miR‐133b‐3p in PC12 cells results in a decrease of Pitx3
mRNA and protein expression. However, Pitx3 expression were rescued after miR‐133b‐3p‐treated cells were transfected with pcDNA/XIST, which was due to the inhibition of the expression and activity of miR‐133b‐3p. Moreover, after PC12 cells were trans- fected with pcDNA/XIST, Pitx3 mRNA and protein expression were increased compared to cells transfected with pcDNA‐NC (Figure 4d,e). These all suggest that XIST modulates depression of Pitx3 by targeting miR‐133b‐3p.

⦁ | AM1241 or overexpression of Xist enhanced Pitx3 expression in vitro

A PD cellular model was established using 6‐OHDA. To obtain an appropriate PD model, PC12 cells were administered different concentrations of 6‐OHDA. The in vivo and in vitro model used in our research are a little different, the drugs used are MPTP and
6‐ODHA, both verified in other studies. Moreover, AM1241 was given later than MPTP in vivo and before 6‐ODHA in vitro. In vitro, we tested the same condition as in vivo, namely 6‐OHDA was given
before AM1241, and we found that the cell survival of PC12 was too low to distinguish the difference between the rescue treatment and
model group, because the concentration of 6‐OHDA we used in vitro
could cause the death of half the cells. We assume that in the in vitro condition, cells directly exposed to the drug were more sensitive than in vivo, thus we applied a pretreatment of AM1241 in vitro.
As shown in Figure 5a, increasing 6‐OHDA concentrations
resulted in sharp decreases in PC12 cell survival. Cells
administered 6‐OHDA exhibited approximately 50% cell survival at a concentration of 200 µM (Figure 5a), thus 200 µM 6‐OHDA
was used in subsequent experiments. The protective effects of AM1241 and overexpression of XIST were investigated in PC12 cells in vitro. The results showed that both AM1241 and pcDNA/ XIST increased cell survival, with 20 µM AM1241 and 100 ng pcDNA/XIST producing the greatest improvements (Figure 5b).
6‐OHDA decreased Pitx3 protein expression in PC12 cells,
and this decrease was rescued by AM1241 and pcDNA/XIST
(Figure 5c). In 6‐OHDA administered cells, the mRNA levels of Xist and Pitx3 were decreased, but miR‐133b‐3p expression was increased. For AM1241 or pcDNA/XIST‐treated cells, Xist
and Pitx3 expression were elevated compared to control, and miR‐133b‐3p expression was decreased (Figure 5d–f). These in vitro results were consistent with the in vivo results.

4 | DISCUSSION

PD as a progressive movement disorder, characterized by the loss of dopamine‐producing cells (Kalia & Lang, 2015). Currently, therapies for PD are still inadequate. The cannabinoid receptors seems to be
emerging as novel therapeutic targets for PD (Celorrio et al., 2017; Concannon, Okine, Finn, & Dowd, 2016; Fernandez‐Ruiz, Romero, &
Ramos, 2015). Due to its potential anti‐inflammatory and antioxidant
activities, and a lack of psychoactive adverse reactions, CB2R activation represents a promising therapeutic target disease mod- ification of PD. The CB2R selective agonist AM1241 has great potential for treating PD.
In our study, we used an acute PD model, this model still needs improvement, and the major limitation for this model is that it's unstable. It is reported that MPTP injected PD models in mouse shows spontaneous recovery after few days, which may affect the final results. To avoid this, after MPTP treatment, the mice had 72 hr off and then the behavioral change was studied again to make sure of the success of the PD model for further drug administration.
In our study, we noticed that our experimental design is similar to clinical conditions, because the drug was given after the PD model was established. Usually, the patents found PD when the motor deterioration gets initiated and more than 60–70% death of dopaminergic neurons takes place, so the drug given after PD is obviously more important than before PD gets diagnosed. Many researchers focus on the drug given together with MPTP, which is hard to translate to clinical conditions.
In this study, our in vivo results revealed that AM1241 induced motor function recovery, increased neurotransmitter release, im-
proved TH+ dopaminergic neuron survival, and induced high mRNA
expression of Park2, Nr4a2, and Pitx3 in MPTP‐treated WT and CB1‐ KO animals. However, these effects were not observed in CB2‐KO mice, which suggests that AM1241 exerts neuroprotective effects
through CB2R. AM1241 acts as a potent and selective agonist for the cannabinoid receptor CB2, with a Ki of 3.4 nM for CB2 and 80× selectivity over the related CB1 receptor (Ibrahim et al., 2003;
Marriott & Huffman, 2008). Thus, in CB1‐KO mice, AM1241 can
signal through CB2 to protect the mice from the neurotoxicity of

FIG U RE 4 Correlation between XIST and the miR‐133b‐3p target, Pitx3 mRNA. (a) Binding regions between miR‐ 133b‐3p and XIST, and miR‐133b‐3p and Pitx3. Bioinformatics analyses including ChipBase, lncRNAdb, and StarBase were used for prediction. (b) XIST‐WT and XIST‐ Mut reporter plasmids were cotransfected into PC12 cells with miR‐133b‐3p or miR‐NC. (c) Luciferase activity was determined in PC12 cells after the Pitx3 WT and Pitx3 Mut luciferase reporters were cotransfected into cells with miR‐NC, miR‐133b‐3p, miR‐133b‐3p and pcDNA‐ NC or miR‐133b‐3p and pcDNA/XIST. (d) Western blot analysis and (e) qPCR analyses of the protein and mRNA expression of Pitx3 following treatment of PC12 cells with miR‐NC, miR‐133b‐3p, miR‐ 133b‐3p + pcDNA‐NC, or miR‐133b‐3p + pcDNA/XIST. 3′‐UTR, 3′‐untranslated region; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase;; miR, microRNA; mRNA, messenger RNA; Mut, mutant; NC, negative control;
pcDNA, protamine complementary DNA; qPCR, quantitative polymerase chain reaction; WT, wild type

MPTP. These results demonstrated that CB2 is necessary for AM1241 to exert its neuroprotective effects.
To better understand the mechanisms involved in AM1241 neuroprotection, we performed RNA‐seq analysis. The results of this analysis suggested that Xist may be an important gene in regulation
of PD. Many studies have identified Xist as important in PD (Carrette et al., 2018; Sun et al., 2014). However, the molecular mechanisms of Xist in PD have not been characterized. We found that MPTP
decreased the expression of Xist, and this decrease was rescued by AM1241 or L‐DOPA in WT and CB1‐KO mice. However, AM1241
did not enhance Xist expression in CB2‐KO PD mice. RNA‐seq and
qRT‐PCR results demonstrated that Xist may be regulated by CB2
directly and that Xist is important in PD recovery.
We hypothesized that Xist as a ceRNA affects cellular control. To evaluate this hypothesis, we performed a bioinformatics analysis together with luciferase assays to find the potential targets of Xist.

FIG U RE 5 AM1241 or overexpression of XIST exerted protective effects in vitro. (a) Cellular model of PD using 6‐ OHDA. (b) Effect of AM1241 or overexpression of XIST on PC12 cell survival. (c) Protein expression of Pitx3. (d–f) Xist, miR‐133b‐3p, and Pitx3 mRNA expression. 6‐OHDA, 6‐hydroxydopamine; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; miR, microRNA; mRNA, messenger RNA; PD, Parkinson's disease

Interestingly, we found that miR‐133b‐3p with Xist can form complementary base pairs, and induce translational repression of a
Xist reporter gene. To determine whether Xist‐induced reduction of miR‐133b‐3p resulted in reactivation of its mRNA targets, and thus

FIG U RE 6 Schematic representation showing the proposed mechanism by which the CB2 agonist AM1241 exerts
neuroprotective effects through the Xist/miR‐133b‐3p/Pitx3 axis.
CB2R, cannabinoid receptor type II; GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; miR, microRNA
promoted PD recovery, we investigated the target mRNA of miR‐133b‐3p. Pitx3 was predicted to be a potential target of
miR‐133b‐3p by a bioinformatics study. This association was also
validated using a luciferase reporter assay and western blot analysis
(Figures 4 and 5). Our results suggested that Xist acts as a ceRNA for miR‐133b‐3p to epigenetically regulate Pitx3.
Our study demonstrated that AM1241 signaled through CB2R to
exert its neuroprotective effects in PD. Xist, which is regulated by CB2R, is important in PD recovery. Xist expression was greatly decreased in PD mouse models, and Xist could promote PD recovery
by decreasing miR‐133b‐3p and increasing Pitx3. Both in vitro and in
vivo experiments were performed to study the mechanisms of the Xist/miR‐133b‐3p/Pitx3 axis in regulating PD development. Thus, we propose a potential ceRNA regulatory network including Xist and miR‐133b‐3p in the modulation of Pitx3 (Figure 6). These results improved our understanding of the underlying signaling mechanisms
in PD. In summary, our findings implied that AM1241 can act as a novel therapeutic drug for PD treatment.

ACKNOWLEDGMENTS

This study was financially supported by the National Natural Science Foundation of China (Grant nos. 81671105, 81873994, 31727801, and 31770923), the National key research and development program (Grant no. 2016YFA0100800), and the Funds for International Cooperation and Exchange of the National Natural Science Foundation of China (Grant no. 8182010801).

10 |

CONFLICT OF INTERESTS

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

AUTHOR CONTRIBUTIONS

All authors contributed to the research. RRZ, SLW, LJJ conceived the experiments. XLH, LY, RQH, LJL, YJS, LMC conducted the experi- ments and analyzed the results. All authors contributed to the writing and editing of the manuscript.

DATA AVAILABILITY STATEMENT

The data that support the findings of this study are available from the corresponding author upon reasonable request.

ORCID

Xiaolie He http://orcid.org/0000-0002-1574-2416

REFERENCES

Atwood, B. K., & Mackie, K. (2010). CB2: A cannabinoid receptor
with an identity crisis. British Journal of Pharmacology, 160(3), 467–479. https://doi.org/10.1111/j.1476‐5381.2010.00729.x
Blandini, F., & Armentero, M. T. (2012). Animal models of Parkinson's
disease. FEBS Journal, 279(7), 1156–1166. https://doi.org/10.1111/j. 1742‐4658.2012.08491.x
Carrette, L. L. G., Blum, R., Ma, W., Kelleher, R. J., 3rd, & Lee, J. T. (2018).
Tsix‐Mecp2 female mouse model for Rett syndrome reveals that low‐level MECP2 expression extends life and improves neuromotor
function. Proceedings of the National Academy of Sciences of the United States of America, 115(32), 8185–8190. https://doi.org/10.1073/pnas.
1800931115
Celorrio, M., Rojo‐Bustamante, E., Fernandez‐Suarez, D., Saez, E., Estella‐Hermoso de Mendoza, A., Muller, C. E., … Aymerich, M. S. (2017). GPR55: A therapeutic target for Parkinson's disease?
Neuropharmacology, 125, 319–332. https://doi.org/10.1016/j. neuropharm.2017.08.017
Coccurello, R., & Bisogno, T. (2016). The bright side of psychoactive substances: Cannabinoid‐based drugs in motor diseases. Expert Review of Clinical Pharmacology, 9, 1–12. https://doi.org/10.1080/17512433.
2016.1209111
Concannon, R. M., Okine, B. N., Finn, D. P., & Dowd, E. (2016).
Upregulation of the cannabinoid CB2 receptor in environmental and viral inflammation‐driven rat models of Parkinson's disease. Experimental Neurology, 283(Pt A), 204–212. https://doi.org/10.1016/j.
expneurol.2016.06.014
Connolly, B. S., & Lang, A. E. (2014). Pharmacological treatment of Parkinson disease: A review. Journal of the American Medical Association, 311(16), 1670–1683. https://doi.org/10.1001/jama.2014.
3654
Djamshidian, A., & Poewe, W. (2016). Apomorphine and levodopa in Parkinson's disease: Two revolutionary drugs from the 1950′s. Parkinsonism & Related Disorders, 33(Suppl. 1), S9–s12. https://doi.
org/10.1016/j.parkreldis.2016.12.004
Dong, H., Li, R., Yu, C., Xu, T., Zhang, X., & Dong, M. (2015). Paeoniflorin inhibition of 6‐hydroxydopamine‐induced apoptosis in PC12 cells via suppressing reactive oxygen species‐mediated
PKCdelta/NF‐kappaB pathway. Neuroscience, 285, 70–80. https://doi.
org/10.1016/j.neuroscience.2014.11.008
Feng, Y., Jankovic, J., & Wu, Y. C. (2015). Epigenetic mechanisms in Parkinson's disease. Journal of the Neurological Sciences, 349(1‐2), 3–9. https://doi.org/10.1016/j.jns.2014.12.017
Fernandez‐Ruiz, J., Romero, J., & Ramos, J. A. (2015). Endocannabinoids and Neurodegenerative Disorders: Parkinson's Disease, Huntington's
Chorea, Alzheimer's Disease, and Others. Handbook of Experimental Pharmacology, 231, 233–259. https://doi.org/10.1007/978‐3‐319‐ 20825‐1_8
Garcia, M. C., Cinquina, V., Palomo‐Garo, C., Rabano, A., & Fernandez‐
Ruiz, J. (2015). Identification of CB(2) receptors in human nigral neurons that degenerate in Parkinson's disease. Neuroscience Letters, 587, 1–4. https://doi.org/10.1016/j.neulet.2014.12.003
Garcia‐Gutierrez, M. S., Garcia‐Bueno, B., Zoppi, S., Leza, J. C., &
Manzanares, J. (2012). Chronic blockade of cannabinoid CB2 receptors induces anxiolytic‐like actions associated with alterations in GABA(A) receptors. British Journal of Pharmacology, 165(4), 951–964. https://doi.org/10.1111/j.1476‐5381.2011.01625.x
Greco, R., Mangione, A. S., Sandrini, G., Nappi, G., & Tassorelli, C. (2014). Activation of CB2 receptors as a potential therapeutic target for migraine: Evaluation in an animal model. The Journal of Headache and
Pain, 15, 14. https://doi.org/10.1186/1129‐2377‐15‐14
Grunblatt, E., Zander, N., Bartl, J., Jie, L., Monoranu, C. M., Arzberger, T., … Riederer, P. (2007). Comparison analysis of gene expression patterns between sporadic Alzheimer's and Parkinson's disease. Journal of Alzheimer's Disease, 12(4), 291–311.
He, X., Yang, L., Wang, M., Zhuang, X., Huang, R., Zhu, R., & Wang, S. (2017). Targeting the endocannabinoid/CB1 receptor system for
treating major depression through antidepressant activities of curcumin and dexanabinol‐loaded solid lipid nanoparticles. Cellular Physiology and Biochemistry, 42(6), 2281–2294. https://doi.org/10.
1159/000480001
He, X., Zhu, Y., Wang, M., Jing, G., Zhu, R., & Wang, S. (2016).
Antidepressant effects of curcumin and HU‐211 coencapsulated solid lipid nanoparticles against corticosterone‐induced cellular and animal models of major depression. International Journal of
Nanomedicine, 11, 4975–4990. https://doi.org/10.2147/ijn.s109088 Hurley, M. J., Mash, D. C., & Jenner, P. (2003). Expression of cannabinoid
CB1 receptor mRNA in basal ganglia of normal and parkinsonian
human brain. Journal of Neural Transmission, 110(11), 1279–1288. https://doi.org/10.1007/s00702‐003‐0033‐7
Ibrahim, M. M., Deng, H., Zvonok, A., Cockayne, D. A., Kwan, J., Mata, H. P.,
… Malan, T. P., Jr. (2003). Activation of CB2 cannabinoid receptors by AM1241 inhibits experimental neuropathic pain: Pain inhibition by receptors not present in the CNS. Proceedings of the National Academy of Sciences of the United States of America, 100(18), 10529–10533. https://doi.org/10.1073/pnas.1834309100
Jiang, L. S., Pu, J., Han, Z. H., Hu, L. H., & He, B. (2009). Role of
activated endocannabinoid system in regulation of cellular cholesterol metabolism in macrophages. Cardiovascular Research, 81(4), 805–813. https://doi.org/10.1093/cvr/cvn344
Kalia, L. V., & Lang, A. E. (2015). Parkinson's disease. Lancet, 386(9996), 896–912. https://doi.org/10.1016/s0140‐6736(14)61393‐3
Van Laere, K., Casteels, C., Lunskens, S., Goffin, K., Grachev, I. D.,
Bormans, G., & Vandenberghe, W. (2012). Regional changes in type 1 cannabinoid receptor availability in Parkinson's disease in vivo. Neurobiology of Aging, 33(3), 620.e621–628. https://doi.org/10.1016/ j.neurobiolaging.2011.02.009
Majidinia, M., Mihanfar, A., Rahbarghazi, R., Nourazarian, A., Bagca, B., & Avci, C. B. (2016). The roles of non‐coding RNAs in Parkinson's

disease. Molecular Biology Reports, 43(11), 1193–1204. https://doi.org/ 10.1007/s11033‐016‐4054‐3
Malek, N., & Grosset, D. G. (2015). Medication adherence in patients with
Parkinson's disease. CNS Drugs, 29(1), 47–53. https://doi.org/10.1007/ s40263‐014‐0220‐0
Marriott, K. S., & Huffman, J. W. (2008). Recent advances in the
development of selective ligands for the cannabinoid CB(2) receptor. Current Topics in Medicinal Chemistry, 8(3), 187–204.
More, S. V., & Choi, D. K. (2015). Promising cannabinoid‐based therapies
for Parkinson's disease: Motor symptoms to neuroprotection. Molecular Neurodegeneration, 10, 17. https://doi.org/10.1186/s13024‐ 015‐0012‐0
Niu, J., Huang, D., Zhou, R., Yue, M., Xu, T., Yang, J., … Zeng, J. (2017). Activation of dorsal horn cannabinoid CB2 receptor suppresses the expression of P2Y12 and P2Y13 receptors in neuropathic pain rats. Journal of Neuroinflammation, 14(1), 185. https://doi.org/10.1186/
s12974‐017‐0960‐0
Shah, M., Rajagopalan, S., Xu, L., Voshavar, C., Shurubor, Y., Beal, F., … Dutta, A. K. (2014). The high‐affinity D2/D3 agonist D512 protects PC12 cells from 6‐OHDA‐induced apoptotic cell death and rescues
dopaminergic neurons in the MPTP mouse model of Parkinson's disease. Journal of Neurochemistry, 131(1), 74–85. https://doi.org/10. 1111/jnc.12767
Shi, J., Cai, Q., Zhang, J., He, X., Liu, Y., Zhu, R., & Jin, L. (2017). AM1241
alleviates MPTP‐induced Parkinson's disease and promotes the regeneration of DA neurons in PD mice. Oncotarget, 8(40),
67837–67850. https://doi.org/10.18632/oncotarget.18871
Soukup, S. F., Vanhauwaert, R., & Verstreken, P. (2018). Parkinson's disease: Convergence on synaptic homeostasis. EMBO Journal, 37, https://doi.org/10.15252/embj.201898960
Suarez, L. M., Alberquilla, S., Garcia‐Montes, J. R., & Moratalla, R. (2018).
Differential synaptic remodeling by dopamine in direct and indirect striatal projection neurons in Pitx3(−/−) mice, a genetic model of Parkinson's disease. Journal of Neuroscience, 38(15), 3619–3630.

https://doi.org/10.1523/jneurosci.3184‐17.2018

Sun, A. G., Wang, J., Shan, Y. Z., Yu, W. J., Li, X., Cong, C. H., & Wang, X.
(2014). Identifying distinct candidate genes for early Parkinson's disease by analysis of gene expression in whole blood. Neuro Endocrinology Letters, 35(5), 398–404.
Ternianov, A., Perez‐Ortiz, J. M., Solesio, M. E., Garcia‐Gutierrez, M. S., Ortega‐Alvaro, A., Navarrete, F., … Manzanares, J. (2012). Overexpression of CB2 cannabinoid receptors results in
neuroprotection against behavioral and neurochemical alterations induced by intracaudate administration of 6‐hydroxydopamine. Neurobiology of Aging, 33(2), 421.e421–416. https://doi.org/10.1016/
j.neurobiolaging.2010.09.012
Walsh, S., Mnich, K., Mackie, K., Gorman, A. M., Finn, D. P., & Dowd, E. (2010). Loss of cannabinoid CB1 receptor expression in the 6‐ hydroxydopamine‐induced nigrostriatal terminal lesion model of
Parkinson's disease in the rat. Brain Research Bulletin, 81(6), 543–548. https://doi.org/10.1016/j.brainresbull.2010.01.009
Whitfield, A. C., Moore, B. T., & Daniels, R. N. (2014). Classics in chemical neuroscience: Levodopa. ACS Chemical Neuroscience, 5(12), 1192–1197. https://doi.org/10.1021/cn5001759
Wu, P., Zuo, X., Deng, H., Liu, X., Liu, L., & Ji, A. (2013). Roles of long noncoding RNAs in brain development, functional diversification and neurodegenerative diseases. Brain Research Bulletin, 97, 69–80. https://doi.org/10.1016/j.brainresbull.2013.06.001
Wutz, A., & Jaenisch, R. (2000). A shift from reversible to irreversible X inactivation is triggered during ES cell differentiation. Molecular Cell, 5(4), 695–705.
Yu, S. J., Reiner, D., Shen, H., Wu, K. J., Liu, Q. R., & Wang, Y. (2015).
Time‐dependent protection of CB2 receptor agonist in stroke.
PLOS One, 10(7):e0132487. https://doi.org/10.1371/journal.pone. 0132487
Zhang, H. Y., Gao, M., Liu, Q. R., Bi, G. H., Li, X., Yang, H. J., … Xi, Z. X.
(2014). Cannabinoid CB2 receptors modulate midbrain dopamine neuronal activity and dopamine‐related behavior in mice. Proceedings of the National Academy of Sciences of the United States of America,
111(46), E5007–E5015. https://doi.org/10.1073/pnas.1413210111

How to cite this article: He X, Yang L, Huang R, et al.
Activation of CB2R with AM1241 ameliorates neurodegeneration via the Xist/miR‐133b‐3p/Pitx3 axis. J Cell Physiol. 2020;1–11. https://doi.org/10.1002/jcp.29530