7.2.0 software. The sequences were aligned using ClustalW and a consensus sequence

for each gene was used for specific primer design (Table 2). PCR was performed in a final volume of 25 μL containing 20 mM Tris–HCl, pH 8.4, 5 mM KCl, 1.5 mM MgCl2, 100 μM of each dNTP, 5 pmol of each forward and reverse primer, 2.5 U Taq DNA polymerase (Invitrogen, São Paulo, Brazil), and 2 μL of genomic DNA. The amplification reactions were performed in a Veriti® 96-well Thermal Cycler (Applied Biosystems) with an initial denaturation at 95°C for 1 min, followed by 35 cycles of 95°C for 30 s, Emricasan order annealing at 60°C for 1 min and an extension step at 72°C for 45 s. Negative control reactions without any template DNA were carried out simultaneously. The identity of the see more amplicons was confirmed after determination of the nucleotide sequences with a 3730xl DNA Analyzer (Applied Biosystems) using the Big Dye® Terminator v.3.1 Cycle Sequencing Kit. Search for homologies in the GenBank/EMBL databases was carried out with the Blast algorithm. Table 2 Description of primers used in PCR for the detection of virulence markers and erythromycin/clindamycin-resistance genes Target genea

Sequence of the primer (5′ → 3′) Amplicon size (bp) Accession numberb hylB F: TGTCTCCGAGGTGACACTTGAACT 124 U15050.1/Y15903.1 R: TTGTGTTGTGACGGGTTGTGGATG cylE F: TCGGAACAAGTAAAGAGGGTTCGG 130 AF093787.2/AF157015.2 R: GGGTTTCCACAGTTGCTTGAATGT PI-1 F: AACCACTAGCAGGCGTTGTCTTTG 147 EU929540.1/EU929469.1 R: TGAGCCCGGAAATTCTGATATGCC Androgen Receptor Antagonist datasheet PI-2a F: GCCGTTAGATGTTGTCTTCGTACT 117 EU929374.1/EU929330.1 R: TTTACTGCGGTCCCAAGAGCTTC PI-2b F: AAGTCTTGACCAAGGATACGACGC 152 EU929426.1/EU929391.1 R: ATCGTGTTACTTGCCCTGCGTA ermA F: CCGGCAAGGAGAAGGTTATAATGA 190 EU492925.1/EU492926.1 R: GCATTCACCCGTTGACTCATTTCC ermB F: GCTCTTGCACACTCAAGTCTCGAT 117 EF422365.1/DQ250996.1 R: ACATCTGTGGTATGGCGGGTAAGT mefA/E F: GCGATGGTCTTGTCTATGGCTTCA 225 DQ445273.1/DQ445269.1   R: AGCTGTTCCAATGCTACGGAT     a hylB, hyaluronate lyase; cylE, hemolysin/cytolysin (β-H/C); PI-1, PI-2a, PI-2b, pilus islands; ermA, ermB cross-resistance to macrolides-lincosamide-streptogramin

B; mefA/E resistance only to 14- and 15-membered ring macrolides. bThe nucleotide sequences of Streptococcus Bupivacaine agalactiae genes deposited in the GenBank/EMBL databases used for specific primer design. Ethics statements The study protocol was approved by the Ethics Committee of the Universidade Estadual de Londrina (Document 186/09-CEP/UEL). Written informed consent was obtained from the patients for the publication of this report and any accompanying images. Acknowledgements This study was supported by grants from Decit/SCTIE/MS/CNPq, FundaçãoAraucária e SESA-PR (Edital PPSUS: Gestão Compartilhada em Saúde – 2011). This work was part of the M.Sc. dissertation of E.S. Otaguiri, who received a student scholarship from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES). We thank Dr. A.